Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN79307

FASTA Sequence
Unigene ID: UN79307Length: 255 SSR 
AGGCTCTCTCCTGATTTCGTTCGTGCACTTTCTCTCTCTCTCTTCGTTAGTTTGATCTTCTACTGTGTTCATCTTCTCTCTCCAGA
TAAAAAGACAAGTTGTGGTGCAAACTAAGAGATCTCATGTCTTATCGATTGGAAAGTGTGGACAAGGAGGGTTTGGGTACATCACC
TGGTCTGAAGGAACGCAACTACTTCGGTTTGTCTGATTGCTCCTCTGTTGACAGCTCAACCCTTCCCAATGCTGACAAGAAGA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_001189579 auxin-responsive protein IAA8 [Arabidopsis thaliana]1743e-011
BAJ33826 unnamed protein product [Thellungiella halophila]1734e-011
ADL70569 indole-3-acetic acid inducible 8 [Arabidopsis thaliana]1653e-010
NP_179852 auxin-responsive protein IAA8 [Arabidopsis thaliana]1627e-010
NP_850028 auxin-responsive protein IAA8 [Arabidopsis thaliana]1627e-010

Swiss-Prot top hits (Blast detail)Scoree value
Q38826 Auxin-responsive protein IAA81622e-011

TrEMBL top hits (Blast detail)Scoree value
Q3EBW5 Putative uncharacterized protein At2g22670.21625e-010

Arabidopsis top hits (Blast detail)Scoree value
AT2G22670.1 IAA8; transcription factor1622e-012
AT2G22670.2 IAA8; transcription factor1622e-012
AT2G22670.3 IAA8; transcription factor1622e-012

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
71  100%

Unigene Members