Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN79811

FASTA Sequence
Unigene ID: UN79811Length: 693 SSR 
GGAAAAGCCAAAGCTTGGCTGCTTCCTTTCTCTCACTCTCTCTCTCTCTCTCACTTTTCTCGCCGCTGATCCTCTCTTCCTTTGCG
TCCATTTCTCCGAGATATTTTCCCCTACACGAGGGTGGTGTGGCGAATGATGAGATGAGGAATCGGTAAATCAAAAATCAAAATAA
ATAAAATAATAATAATCTCTGCAATGTCGTCGACTTCTTTGCAAACGATTGGTGCGATAAAGGCTTATCATCATCAAGCGCAGCAT
TTGGTTAACAACTATCTCTTGGCTGATCCTTTTATTCCTTACACTTCTATTCTCACCGGCATGTTCCTCTGCAAAGTGGTCTATGA
TCTTTGTCACTTCATCAGCAACTCCCATTCCAAGACCTATATCATCCTCACCAAGATTCAACGTATCGAATGGAACAACCGTGGTA
TCTCGACGGTTCATGCTATCTTTATCTCCGCAATGTCCCTCTACTTTGTCTTCTGGTCCGATCTCTTTTCTGATAGGTGGCACAAT
GATCTTGTTGTCTTCCGCAGCTCACGTCTTTCCTCTCTTGGTTTAGGGTTATCCATTGGTTACTTCATTGCTGATCTTGGGATGAT
CTTCTGGAAATATCCTTCTTTGGGTGGACTTGAGTATATTGTCCATCACTCGCTCTCGGGGGTAGCTGTTGCCTACTCCTTGTTTT
CTGGG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_564377 TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein [Arabidopsis thaliana]8494e-089
XP_002893848 hypothetical protein ARALYDRAFT_473644 [Arabidopsis lyrata subsp. lyrata]8461e-088
BAH19941 AT1G31300 [Arabidopsis thaliana]8352e-087
AAF24587 T19E23.9 [Arabidopsis thaliana]7643e-079
XP_002263050 PREDICTED: hypothetical protein [Vitis vinifera]5923e-059

Swiss-Prot top hits (Blast detail)Scoree value
Q6PGS5 Transmembrane protein 56-B1297e-007
Q5XIY2 Transmembrane protein 56-B1233e-006
Q8CGF5 Transmembrane protein 561224e-006

TrEMBL top hits (Blast detail)Scoree value
Q93Z82 At1g31300/T19E23_128493e-089
B9DGS4 AT1G31300 protein8351e-087
Q9SHF1 T19E23.97642e-079
B9ICG7 Predicted protein5878e-059
B9NA48 Predicted protein5842e-058

Arabidopsis top hits (Blast detail)Scoree value
AT1G31300.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G19645.2); Has 478 Blast hits to 478 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 269; Fungi - 98; Plants - 80; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).8492e-091
AT1G31300.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G19645.2); Has 478 Blast hits to 478 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 269; Fungi - 98; Plants - 80; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).8492e-091
AT4G19645.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G31300.2); Has 401 Blast hits to 401 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 186; Fungi - 102; Plants - 84; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).5688e-059
AT4G19645.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G31300.2); Has 401 Blast hits to 401 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 186; Fungi - 102; Plants - 84; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).5688e-059
AT4G10360.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G31300.2); Has 453 Blast hits to 451 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 225; Fungi - 97; Plants - 91; Viruses - 3; Other Eukaryotes - 37 (source: NCBI BLink).3393e-032

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
71  100%

Unigene Members