Information for unigene UN80052
| FASTA Sequence |
| Unigene ID: UN80052 | Length: 170 |
SSR | | ACCTTGGAAATTAAAAAGGACTAGACACAAAAAAGAAGAAGAAGAAGATAGAACATCAGATGAGACTTGGTATCTTATTTATGGGT
TACATATAACGAGTTTAATAATACGAAGGTGGGGGAGGAGATTTGTATTCGGCCTTTGGAGATGGAGAGTATGTTGGTGGTGGT
|
|
|
| GenBank top hits | Score | e value |
|---|
| No hits found | | |
| Swiss-Prot top hits | Score | e value |
|---|
| No hits found | | |
| TrEMBL top hits | Score | e value |
|---|
| No hits found | | |
| Arabidopsis top hits (Blast detail) | Score | e value |
|---|
| AT1G23720.1 proline-rich extensin-like family protein | 119 | 2e-007 |
| AT3G54590.1 ATHRGP1 (HYDROXYPROLINE-RICH GLYCOPROTEIN); structural constituent of cell wall | 113 | 1e-006 |
| AT3G54580.1 proline-rich extensin-like family protein | 113 | 1e-006 |
| EST library breakdown for ESTs in the assembly |
| Library |
ESTs | Percentage of ESTs in assembly |
|
|
| Unigene Members | |
 |
|
|
