Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN80299

FASTA Sequence
Unigene ID: UN80299Length: 774 SSR 
GAAGTTACCATCTGCTCCCAAGCCGATGTTGCGTTAACCCTCTTGAGAGAAAGAAAAGGCTGTTTCGATTTGGTCTTAAGCGATGT
TCATATGCCTGGTATGAACGGTTACAAGCTTCTCCAGCAAGTCGGTCTTGAGATGGATCTCCCTGTCATCATGATGTCTGTTGATG
GAAGAACAGCGACGGTGATGACGGGAATCAACAACGGAGCTTGTGATTATCTCATTAAGCCGATTCGTCCCGAAGAGCTCAAGAAC
ATATGGCAACATGTGGTTCGCAGGAAATGCACAGTCAGCAAGGAGATTCCAAAAGCTTTAGATAGCAGCAGCAGTTTGGAGAGTCT
TTTCTCTCTTGGCGGAGTCTCAGAGGGGAGTGTGAAACGTAGGAAGAACAAGAGAAGGGTTGTTAGAGAAGAAGAAGAAGAAGATG
ATGATGATCTTCTTGATCCTGGAAACAGTTCCAAGAAGTCGCGTGTTGTTTGGTCCATGGAGTTGCATCAACAATTCGTCAAGGCT
ATAAACCATCTTGGCATTGATAAAGCTGTACCAAAGCGGATTATGGAGTTGATGAACGTGCCTAGATTAAGCAGAGAGAACATAGC
TAGTCATCTACAGAAGTACCGATTGTATTTGAAGAGATTAAGTGGTGTAGCTTCTCAGAGTAAGATGCTGAGTCTATGGAAAGATA
TGAAACATTCAAGCTATGGTTTCTTCAGACAGATACATCCACAGCATAGCTGCCTTGTATGGTCGACCATAGATATCATATGTCTG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAJ34308 unnamed protein product [Thellungiella halophila]8854e-093
XP_002533196 two-component sensor histidine kinase bacteria, putative [Ricinus communis]7143e-073
XP_002311532 type-b response regulator [Populus trichocarpa]7053e-072
XP_002315852 type-b response regulator [Populus trichocarpa]7044e-072
XP_002281291 PREDICTED: hypothetical protein [Vitis vinifera]7026e-072

Swiss-Prot top hits (Blast detail)Scoree value
Q8L9Y3 Two-component response regulator ARR148125e-086
Q9ZWJ9 Two-component response regulator ARR25885e-060
P62598 Two-component response regulator ARR125671e-057
Q9FXD6 Two-component response regulator ARR115527e-056
Q9FGT7 Two-component response regulator ARR184765e-047

TrEMBL top hits (Blast detail)Scoree value
B9T4M7 Two-component sensor histidine kinase bacteria, putative7142e-073
B9HJH2 Type-b response regulator (Fragment)7052e-072
B9HVU5 Type-b response regulator7043e-072
A2XE31 Putative uncharacterized protein6461e-065
Q8H7S7 B-type response regulator6461e-065

Arabidopsis top hits (Blast detail)Scoree value
AT2G01760.1 ARR14 (ARABIDOPSIS RESPONSE REGULATOR 14); transcription factor/ two-component response regulator8125e-087
AT4G16110.1 ARR2 (ARABIDOPSIS RESPONSE REGULATOR 2); transcription factor/ two-component response regulator5884e-061
AT2G25180.1 ARR12 (ARABIDOPSIS RESPONSE REGULATOR 12); transcription factor/ two-component response regulator5705e-059
AT1G67710.1 ARR11 (RESPONSE REGULATOR 11); transcription factor/ two-component response regulator5527e-057
AT5G58080.1 ARR18 (ARABIDOPSIS RESPONSE REGULATOR 18); transcription factor/ two-component response regulator4764e-048

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
81  100%

Unigene Members