Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN80467

FASTA Sequence
Unigene ID: UN80467Length: 732 SSR 
GGATGCCTCAGTATGGTCATCAACATCCTCATTGCCCGCCTAATCATCTGAATGGAATGACAGGGTTTCCTTATTACCACCACCAC
CCCATGAACACATCGTTACAGCACAGTCAGATGTCACAGAATGGTCAGGTGCCTTTACAGAATGGTCAGATGCCTATGGTCCATCA
TCATCATCATTCTTGGCCACAGACACAGATAGGAAACCACCCGTCTCCTAACGAGGTGAGAGTGACTAAGCTTGACAGAAGAGAGG
AAGCGTTGCTTAAATTTAGACGTAAAAGGAACCAAAGGTGTTTTGACAAGAAGATTAGGTATGTGAATAGGAAGCGGCTTGCTGAG
AGGAGACCACGTGTTAAGGGTCAGTTTGTTAGGAAAATGTACGGCGTGAATGTTGACTTAAACGGTCAGCCTGAGCCTGACTCAGC
TGATTATGATGACGAGGAAGAGGAGGATGAAGAAGAAGAGGAGAATCGAGACTCATCTCCTCAGGATGATGCTCTTGGAACTTGAG
AAACATGGGAGAGAACTGAAAACCGTGTTTGGTTTTATATCAAGAATGACGGTGGTAGAGCCAAAAAAACATTGGATATGTAACTC
ACTTGCAAAAGGAAATAATGGCTCAGCTTTGAGCATTGAAAATCACTATGTAGGTGTGTGGCTTAGTTCGTTGATAGACATACGAT
GTGTTTGATCATGTTCTATTCACGTTCAGTGAGTTATGTAAAAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ADA58339 pseudo-response regulator 1a [Brassica rapa]8111e-084
CAB75508 ABI3-interacting protein, AIP1 [Arabidopsis thaliana]6793e-069
NP_200946 two-component response regulator-like APRR1 [Arabidopsis thaliana]6793e-069
XP_002864730 hypothetical protein ARALYDRAFT_496297 [Arabidopsis lyrata subsp. lyrata]6514e-066
ADA58344 pseudo-response regulator 1b [Brassica rapa]6416e-065

Swiss-Prot top hits (Blast detail)Scoree value
Q9LKL2 Two-component response regulator-like APRR16843e-071
Q689G9 Two-component response regulator-like PRR12193e-017
Q689G6 Two-component response regulator-like PRR951791e-012
Q93WK5 Two-component response regulator-like APRR71763e-012
Q8L500 Two-component response regulator-like APRR91727e-012

TrEMBL top hits (Blast detail)Scoree value
D2KK85 Pseudo-response regulator 1a8119e-085
D2KK90 Pseudo-response regulator 1b6415e-065
B9N4C8 Pseudo response regulator3701e-033
C0SNP3 Timing of CAB expression 13701e-033
B9RLV6 Sensory transduction histidine kinase, putative3692e-033

Arabidopsis top hits (Blast detail)Scoree value
AT5G61380.1 TOC1 (TIMING OF CAB EXPRESSION 1); transcription regulator/ two-component response regulator6852e-072
AT5G02810.1 PRR7 (PSEUDO-RESPONSE REGULATOR 7); transcription regulator/ two-component response regulator1762e-013
AT2G46790.2 APRR9 (ARABIDOPSIS PSEUDO-RESPONSE REGULATOR 9); protein binding / transcription regulator/ two-component response regulator1727e-013
AT2G46670.1 pseudo-response regulator, putative / timing of CAB expression 1-like protein, putative1727e-013
AT2G46790.1 APRR9 (ARABIDOPSIS PSEUDO-RESPONSE REGULATOR 9); protein binding / transcription regulator/ two-component response regulator1727e-013

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
81  100%

Unigene Members