Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN80636

FASTA Sequence
Unigene ID: UN80636Length: 221 SSR 
GCGTTCAGGCATGTTTTGAAGCTAGCGGCCTCCTCCTCGCCAGCCGGAAACAGACTTGGGGACAAGTGAAATGGAGTTAGAGGCAG
CTTCTAATCTGCACAATGCCCGAAAGTGAATCTGTTTATCCCAATGAAACACAACAGTAGTTAGATGAGAGAGAGAGAGAGAGGGA
GCTACTGCCTACTTGGATATTTCTTCCACAGCCTTGATGACTTCATCGG

Annotation (GO term)
GenBank top hits Scoree value
No hits found  

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits Scoree value
No hits found  

Arabidopsis top hits Scoree value
No hits found  

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
81  100%

Unigene Members