Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN80643

FASTA Sequence
Unigene ID: UN80643Length: 742 SSR 
GGAGGATTATGTAGTGTTTCGTCTCGTGTGTTGTTGTTCTCTTCTTCTCCTCCTTCCCCCTTCACAATCACAATCACAATCACGTT
AATTAAAGCTAAAGCCTTCGTTGATGCTACTTCCTATTTACCCTTTCTCTCACTCTCTCGCTTTTCTCGCCGTTTCTAAACAACAC
CTTCCCTTCCTTTGCGTCCCAGAGATTTTTCCTAAAAGAGAGTGTTGATTCTGTTTCTTGGTACCCAAACTTGAAGAGCATCTGTG
ACATATAGATATATCTCTGCAATGTCGACGACTTCTTTGCAGACAATTGGTGCGATCAAGTCTTATCATCACCAAGCTCAGCATTT
GGTTAACAACTATCTCTTAGCTGATCCCTTTATTCCTTACACCTCTGTTCTCACCGGCATTTTCCTTTGCAAAGTGGTCTATGATC
TTTGTCACTTTGTCAGCAACTCACATTCCAAGACATATATCATCCTTACCAAAATTCAGAGAATCGAATGGAACAACCGTGGTATC
TCAACAGTTCATGCCCTTTTTTATCTCTGCTCTCTCTCTCTACTTTGTCTTCTGGTCCGATCTCTTTTCCGATAGGTGGCATAACG
ATCTCGTTGTGTTCCGGAGCTCACGTCTTTCCTCTCTTGGTTTAGGATTATCCATTGGTTACTTCATTGCTGATCTTGGGATGATC
TTATGGAAGTATCCTTCTTTGGGTGGACTTGAGTATATTGTGCATCACTCGCTA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002893848 hypothetical protein ARALYDRAFT_473644 [Arabidopsis lyrata subsp. lyrata]4517e-043
AAF24587 T19E23.9 [Arabidopsis thaliana]4491e-042
NP_564377 TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein [Arabidopsis thaliana]4491e-042
BAH19941 AT1G31300 [Arabidopsis thaliana]4491e-042
XP_002322330 predicted protein [Populus trichocarpa]2967e-025

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
B9DGS4 AT1G31300 protein4499e-043
Q93Z82 At1g31300/T19E23_124499e-043
Q9SHF1 T19E23.94499e-043
B9ICG7 Predicted protein2965e-025
B9NA48 Predicted protein2912e-024

Arabidopsis top hits (Blast detail)Scoree value
AT1G31300.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G19645.2); Has 478 Blast hits to 478 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 269; Fungi - 98; Plants - 80; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).4495e-045
AT1G31300.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G19645.2); Has 478 Blast hits to 478 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 269; Fungi - 98; Plants - 80; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).4495e-045
AT4G19645.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G31300.2); Has 401 Blast hits to 401 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 186; Fungi - 102; Plants - 84; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).2793e-025
AT4G19645.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G31300.2); Has 401 Blast hits to 401 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 186; Fungi - 102; Plants - 84; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).2793e-025
AT4G10360.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G31300.2); Has 453 Blast hits to 451 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 225; Fungi - 97; Plants - 91; Viruses - 3; Other Eukaryotes - 37 (source: NCBI BLink).1252e-007

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
81  100%

Unigene Members