Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN81233

FASTA Sequence
Unigene ID: UN81233Length: 345 SSR 
GGGCTGCAATGGATTGATCATTAAATACCAGTTGCCATTTGGGGAAGGAGGATTGTCACTTGCAGATACCTTTGGATACCTTGAAA
GAAACCGGAATCAGTTGGGCATAGCTGAATACAGCATAAGCCAGTCCACACTTGAGACTATATTCAACCATTTTGCAGCTAACTCA
TAACCAGTGAAACCATTATTGCGGCTTTTGTATAACCCAAAACCCTTCCATGAACACAGCCTAAAGAGAGATCTGATCACTCACCA
AAATAGTCGTATATATGGCACATATGAAAAAACGTGTTCTTAACATTCATATGTATATACACACACACACACTGTTGTAATGTACT
A

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_850354 ABC transporter A family member 1 [Arabidopsis thaliana]2702e-022
NP_001031526 ABC transporter A family member 1 [Arabidopsis thaliana]2702e-022
AAM14842 putative ABC transporter [Arabidopsis thaliana]2702e-022
AAK97688 T32G6.22/T32G6.22 [Arabidopsis thaliana]2702e-022
AAK39643 ATP-binding cassette transporter AtABCA1 [Arabidopsis thaliana]2702e-022

Swiss-Prot top hits (Blast detail)Scoree value
Q84M24 ABC transporter A family member 12707e-024

TrEMBL top hits (Blast detail)Scoree value
B9H9T2 ABC transporter family, cholesterol/phospholipid flippase2306e-018

Arabidopsis top hits (Blast detail)Scoree value
AT2G41700.1 ATPase, coupled to transmembrane movement of substances / amino acid transmembrane transporter2714e-025
AT2G41700.2 ATPase, coupled to transmembrane movement of substances / amino acid transmembrane transporter2714e-025

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
91  100%

Unigene Members