Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN81810

FASTA Sequence
Unigene ID: UN81810Length: 204 SSR 
GTATCAACGTTTAATGAACACAATGAAAGGAGTCTTTAAGAGGGTAGATTGATCTCTCTCTCTCTCTCTTACCTCTCTTGCTCTGT
GGGAACCAACCTTGGATCAAATCACAAGCAGTCCAAACCACATATCTCGAGAATAGGACCACCTTTAGCCACGAACGGGTTAACCC
TAACCCAAAGAAGTGTAAGAATAGAAGCCAAG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_201279 cellulose synthase A catalytic subunit 6 [UDP-forming] [Arabidopsis thaliana]1636e-010
NP_196549 cellulose synthase A catalytic subunit 5 [UDP-forming] [Arabidopsis thaliana]1636e-010
AAK53023 AT5g64740/MVP7_7 [Arabidopsis thaliana]1636e-010
AAC29067 cellulose synthase [Arabidopsis thaliana]1636e-010
AAM97089 cellulose synthase catalytic subunit [Arabidopsis thaliana]1636e-010

Swiss-Prot top hits (Blast detail)Scoree value
Q8L778 Cellulose synthase A catalytic subunit 5 [UDP-forming]1632e-011
Q94JQ6 Cellulose synthase A catalytic subunit 6 [UDP-forming]1632e-011
O48947 Cellulose synthase A catalytic subunit 2 [UDP-forming]1533e-010
Q9SJ22 Probable cellulose synthase A catalytic subunit 9 [UDP-forming]1524e-010
Q69V23 Probable cellulose synthase A catalytic subunit 3 [UDP-forming]1157e-006

TrEMBL top hits (Blast detail)Scoree value
Q0GPY3 Cellulose synthase catalytic subunit1634e-010
A9PHP8 Putative uncharacterized protein1473e-008
B9HGC9 Predicted protein1473e-008
B9HGD0 Predicted protein (Fragment)1473e-008
B9GTH4 Cellulose synthase1421e-007

Arabidopsis top hits (Blast detail)Scoree value
AT5G09870.1 CESA5 (CELLULOSE SYNTHASE 5); cellulose synthase/ transferase, transferring glycosyl groups1641e-012
AT5G64740.1 CESA6 (CELLULOSE SYNTHASE 6); cellulose synthase/ transferase, transferring glycosyl groups1641e-012
AT4G39350.1 CESA2 (CELLULOSE SYNTHASE A2); cellulose synthase/ transferase, transferring glycosyl groups1532e-011
AT2G21770.1 CESA9 (CELLULOSE SYNTHASE A9); cellulose synthase/ transferase, transferring glycosyl groups1523e-011

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
181  100%

Unigene Members