Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN84039

FASTA Sequence
Unigene ID: UN84039Length: 149 SSR 
TCTTTCTCATGAACCCTTCTCTTTCTCTTTCTCCTCCTCCTCCTCCTCCTCCTCCTCCCTGCTCTTCTTCTCCTTCATACCCATTT
GATCTCATCATCATAGCTCCATGGAAGAACACAATCAGAAGTAAAAACGTGAAAATTCTCTTG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002880986 cupin family protein [Arabidopsis lyrata subsp. lyrata]1483e-008
NP_180416 cupin domain-containing protein [Arabidopsis thaliana]1368e-007

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q9SK09 Putative seed storage protein (Vicilin)1366e-007

Arabidopsis top hits (Blast detail)Scoree value
AT2G28490.1 cupin family protein1362e-009

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
211  100%

Unigene Members