Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17078

FASTA Sequence
Unigene ID: UN17078Length: 791  SNP
GTCGTATTCAGCTTCATAGAGAGTAACCAGTGACTTTCGCGGATTTATCGTCTGAAATCAAATAATGGGGAAGGAAAACATCAACT
AAATTGGGCTTTGGAAGAGTAGAATATAGATAACAGCAAAACTTGATCATGTTCCAAACAAATCTCAGAGAGGTGTCTGCTAAAAT
ATCAAGTATCAAAACCAAGATAAAACAGCATTGAGATGGAAAAACATTGGAGAATGCTTCTTAAACTTAGTTAGATTCAATGTGCT
TCTTGACGATATTGAGGGCAGTTGTATCCTCACCGTAGTCCTTGACTACAAGGCATGAGCAACCAACAACCTTCCTGGCATTACCC
TCAGAGTCAATCTTGCAGAGACCAGCCCACTCGCCGAGGGTCTTGGCGCTTGGAACAGTAAGCAAGTTGATGCTGTGATCAGCGCA
GAGAGCCTTAACAAGCTTGACGTAGTCAGGCTGGTTGCAGTCTTCAGCCAAGACACAGAGCTGAGCAACACGCTTCTCAATAAGCT
TAGCGCTCTCATGGAGACCACGGACAACACCACCATGAGCACGAGCTTTCCTTAGAGTCAACTCCAATGCAGTCAACAAGTCCATG
TCCTCTGGGATTGCCGCTGGCTCAGCAACGGGAGGAACAACAACGGGAGCAGCAGCCTCATCACCCGACATGTTGTGTCTTTAAAT
GCTTTTAACTTCCGAAAAAAATTTGTTGTTCTCTCAGAGACGATTGACGGCTGCAGCGGAAAGCCTGAGGAAGAAATTGGGAAACA
AGTTATATGCTACTTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_180766 40S ribosomal protein S12-2 [Arabidopsis thaliana]6614e-067
NP_173045 40S ribosomal protein S12-1 [Arabidopsis thaliana]6552e-066
XP_002887897 predicted protein [Arabidopsis lyrata subsp. lyrata]6158e-062
XP_002890138 40S ribosomal protein S12 [Arabidopsis lyrata subsp. lyrata]5924e-059
XP_002881214 40S ribosomal protein S12 [Arabidopsis lyrata subsp. lyrata]5843e-058

Swiss-Prot top hits (Blast detail)Scoree value
Q9SKZ3 40S ribosomal protein S12-26612e-068
Q9S9P1 40S ribosomal protein S12-16558e-068
Q9XHS0 40S ribosomal protein S125161e-051
Q76I81 40S ribosomal protein S123672e-034
P84175 40S ribosomal protein S123672e-034

TrEMBL top hits (Blast detail)Scoree value
B9GT02 40S ribosomal protein S125636e-056
A9PDC2 40S ribosomal protein S125611e-055
A9P9K3 40S ribosomal protein S125601e-055
A9PJY6 40S ribosomal protein S125564e-055
B9S6H9 40S ribosomal protein S125474e-054

Arabidopsis top hits (Blast detail)Scoree value
AT2G32060.1 40S ribosomal protein S12 (RPS12C)6621e-069
AT2G32060.3 40S ribosomal protein S12 (RPS12C)6621e-069
AT2G32060.2 40S ribosomal protein S12 (RPS12C)6621e-069
AT1G15930.2 40S ribosomal protein S12 (RPS12A)6566e-069
AT1G15930.1 40S ribosomal protein S12 (RPS12A)6566e-069

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
65  11%
 
76  13%
 
195  11%
 
87  15%
 
96  13%
 
119  19%
 
104  9%
 
181  2%
 
123  6%
 
201  2%

Unigene MembersMember information