Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN01056

FASTA Sequence
Unigene ID: UN01056Length: 681 SSR 
GGATAAAAAAGTTATTGCCTTGTCTGGCGCTGGCACATGGGTTTACAAATAATATATCACATAATCGTATCAGACACGACACCATT
TCCCATAAGAAAAAAAAATAGAAAGATTAAATAAATAATAATATATATCTCCATCAAGCAAAAAAAAAATAGAAGAGATATACAAA
GGTGGTTGCAAGAAGGTAGCAGCAGCAGCAGCAGGTACAGTTTACAAAGGAACCAAAGGACCCCCTTACGATGTAGTAGTGTCCCA
AGTTGTTGTTGGTGTCTTGGAACTCCACTCTGTTCTTCCTCTGACCACTTCGGCTCCATCCTGGAGTCGAAGTAAATGCTGACACT
CCACTTCCCCGCCTGTCTCGAGGTTACCGACATCACATCCAGAAACCGCGGTGAGAGACTGAAGCACACTGTCTCTTCCGCACTCC
CTCCGATACTCCAGAGTCATGCTTTTCAGTTTCTGACTCTCCAACATCCCTGCTGGAGCACTCTCCAGTATCCACCCAATGTACTT
TACATTGTTAACATGCTGGTTAACATCCAAGTCACTCCACCTCGGAGTGAGACCAGAACGAACATAGTCAGCGGTCTTGTCATCAA
GTTTGGTTAACTTTCTGCTGTCTTCAGCAATGACAGGATCAGAGTTCACAAAATAAGGCTCTATTTCCCCGCGAACCTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ACR56795 stearoyl ACP thioesterase [Brassica juncea]7312e-075
ACR56793 stearoyl ACP thioesterase [Brassica juncea]7294e-075
ACR56794 stearoyl ACP thioesterase [Brassica juncea]7276e-075
ABI18986 palmitoyl-ACP thioesterase [Brassica juncea]7251e-074
ACR56792 stearoyl ACP thioesterase [Brassica juncea]7251e-074

Swiss-Prot top hits (Blast detail)Scoree value
Q9SQI3 Myristoyl-acyl carrier protein thioesterase, chloroplastic5312e-053
Q39513 Myristoyl-acyl carrier protein thioesterase, chloroplastic4692e-046
Q41635 Lauroyl-acyl carrier protein thioesterase, chloroplastic4065e-039
Q39473 Myristoyl-acyl carrier protein thioesterase, chloroplastic4021e-038
Q42712 Oleoyl-acyl carrier protein thioesterase, chloroplastic (Fragment)2211e-017

TrEMBL top hits (Blast detail)Scoree value
D6BND6 Stearoyl ACP thioesterase7311e-075
D6BND4 Stearoyl ACP thioesterase7292e-075
D6BND5 Stearoyl ACP thioesterase7274e-075
D6BND3 Stearoyl ACP thioesterase7257e-075
Q0GLI8 Palmitoyl-ACP thioesterase7257e-075

Arabidopsis top hits (Blast detail)Scoree value
AT1G08510.1 FATB (fatty acyl-ACP thioesterases B); acyl carrier/ acyl-[acyl-carrier-protein] hydrolase7149e-076
AT3G25110.1 AtFaTA (Arabidopsis FatA acyl-ACP thioesterase); acyl carrier/ acyl-[acyl-carrier-protein] hydrolase2514e-022
AT4G13050.1 acyl-(acyl carrier protein) thioesterase, putative / acyl-ACP thioesterase, putative / oleoyl-(acyl-carrier protein) hydrolase, putative / S-acyl fatty acid synthase thioesterase, putative2183e-018

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
91  50%
 
81  50%

Unigene MembersMember information