Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN10141

FASTA Sequence
Unigene ID: UN10141Length: 1157 SSR 
GGGTGTGTGGCTTGGACAAATGCACTTCCTCTATCCTCTCGAGCTCTCTCTCACTCTCCTCCATGGCGACCACCGCATCCACCTCT
CTCCCACGTAACTACTCCATCCCTCCTCCTCCTCCCTCTTTCACCCGCGCCACGTCATTTCCCAAATCGTTCCCGCTCTATACCCG
CCCCAACCGCCGGTTCTCTCTCACTTACCGTTTAAACCAAAACTCGAAACAGAGGAGTGTAGGAATCGTCAGATGCGAGGCGACGG
AGGTCTCTCCTCCTTCTTCTTCTTCTTCTTCTTCGTCCGTTGCTTCCCCGGGAAGAAACTGGGTGCCGGTGGTGCCGTTATCCGCG
CTTCCGAAAGGTGAACGGAGAGTGATTATCCAAGACGACGAGACGATATTGCTGCTTTGGTATAAGAACGATGTCTTCGCGATTGA
GAACCGTTCTCCCGCCGAAGGAGCCTACAGCGAGGGGCTTCTCAACGCTAAGCTCACTCAGGATGGTTGCATTGTGTGCCCGGCAA
CGGATAGTACATTTGATCTCAGAACCGGAGAGATCAAGGAATGGTACCCAAAGAACCCGGTTCTCAGAGTCTTGACACCTGCACTG
AGAAAGCTGTTTGTGTACCCTGTCAAATTTGATGAAGAAAACATCTACATCAGCATTAGAGGCAACGGGAAGAACGAGGCTGCTGC
TGAAATCGTCTTCAGTGGAAAAGCTCAGCCTGGGCTCACAGCAACCAATGTCAACGTAGACGAGGTGAGGATGGTGGTGGACGAGG
GTTCTCAAGGATTTGGTTTCTCAAGGAAGAACGAAGTGATAAATGGCAAAGCAGCAGTGATAGGATTCTTACTGCTGTTAGATTTT
GAGCTATTGACAGGTAAAGGTCTATTGAAGGGGACAGGGTTCTTGGACTTCCTTTACTCTGCTTCTGATGCTTTCAAGTAGAGATC
AATATATCTATCTTTGGTCTGGTTTTTGCTTTACCTCCCTTGTGCAATTTGTGGAAGCATTATTCAGTAAATGGAGAAACAAACAA
CATACTTTTTAAGTAACAAAATTCACACCATGTCTTAGTATATGAATCACATTTTATAGAGATGTCTTGCCTTTGCTTTGTTTGTG
TGTTTACCTCTTAATATAAGATATTCTTTGTTCTTTCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_565018 Rieske (2Fe-2S) domain-containing protein [Arabidopsis thaliana]12503e-135
XP_002887376 hypothetical protein ARALYDRAFT_476280 [Arabidopsis lyrata subsp. lyrata]12253e-132
XP_002276968 PREDICTED: hypothetical protein [Vitis vinifera]9564e-101
XP_002334345 predicted protein [Populus trichocarpa]9531e-100
XP_002528040 oxidoreductase, putative [Ricinus communis]9369e-099

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q9C9I7 Putative uncharacterized protein12735e-138
B9NGG0 Predicted protein9537e-101
B9SPX1 Oxidoreductase, putative9366e-099
A2ZCZ7 Putative uncharacterized protein9071e-095
Q53N80 Os11g0242400 protein9071e-095

Arabidopsis top hits (Blast detail)Scoree value
AT1G71500.1 Rieske (2Fe-2S) domain-containing protein12742e-140

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
127  37%
 
201  5%
 
192  11%
 
114  21%
 
181  5%
 
211  5%
 
102  11%
 
91  5%

Unigene MembersMember information