Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13782

FASTA Sequence
Unigene ID: UN13782Length: 858 SSRSNP
GGAACATATTTAAAACTGAATAACAACCGGAAAAAAAAGAGGAGAAAAATAAAATAAAACTTCCGACGCATAAAAAATGGCAACGT
TCTCCGCTCTGTCCACTTTCGCCGCGGCGGCAATTACCTTGCAACTACTCCTAGTTCCAGCTTCAGCCTCTCCTCACATGAAATAC
ATTGATGCTATCTGCGATCGCTCCCACGACCAAGATTACTGCGTTAAAACATTGACTACCAACCCCCCTACGGCTGCTCCCATTGG
CCTGAACCCACTCGCCGAGGCCGTGATGGAGCTCACCATAGCCCACGCCGAGAAGACAGCGGCTTTCCTGGACGAGACGGCGAAGA
AAGATCCAGCGGTGCAGGCTGCGTATGCCGAGTACCACAAGGCCTATCTAGCCGTGGTGGCTGATCTCAAGAGCGCAAACCTGAAG
CTCAAGCAATCCCCTGACACGGCTCACTACGACGTTAGGTCTTCGACCGACCAGATGAAGCGCGTGGAGGGATTAGTTGCGAAAAA
CAATGACCAGGCTTCAACCACTCTCAAGGAAATGACCGTGCAGATGGAGAAGCTACTTGATCTTGCAGCTAGTGCCGCCGATGCTG
TGGACGATGATGATGAGAACATCCACCGTCGCGAATGATTTTAAAGCAGTGATCCGGTTTCGTTTTTTTGTGTTCACACTACAAAA
TATAATAAATAAATGAATACATATACACACACACACACAAATGTGGTGTGATAAACTAGTAATTAAGTTCTTGAAATATTTGCAGA
CTGATGTCAATTTTTGGCATATATAAAAAGTTTGCTGTATGATCTTTTTTACAAAACTAAATATAAATATATTTTTTTATTCTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAB48480 pollen-specific protein Bnm1 [Brassica napus]8211e-085
NP_194195 plant invertase/pectin methylesterase inhibitor domain-containing protein [Arabidopsis thaliana]7512e-077
XP_002869708 hypothetical protein ARALYDRAFT_492378 [Arabidopsis lyrata subsp. lyrata]7422e-076
AAD00108 AppB protein [Arabidopsis thaliana]6992e-071
XP_002864028 invertase/pectin methylesterase inhibitor family protein [Arabidopsis lyrata subsp. lyrata]5342e-052

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
P93760 Pollen-specific protein Bnm18218e-086
Q9SB59 Bnm1 like protein7511e-077
Q9ZRF0 AppB protein6991e-071
Q9FGA8 At5g500305153e-050
Q9FZ34 Putative uncharacterized protein F14C21.313031e-025

Arabidopsis top hits (Blast detail)Scoree value
AT4G24640.1 APPB1; enzyme inhibitor/ pectinesterase/ pectinesterase inhibitor7516e-080
AT5G50030.1 invertase/pectin methylesterase inhibitor family protein5151e-052
AT1G54980.1 invertase/pectin methylesterase inhibitor family protein3036e-028
AT5G50070.1 invertase/pectin methylesterase inhibitor family protein2921e-026
AT5G50040.1 invertase/pectin methylesterase inhibitor family protein2892e-026

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
63  9%
 
126  19%
 
107  22%
 
76  19%
 
95  16%
 
112  6%
 
183  9%

Unigene MembersMember information