Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17139

FASTA Sequence
Unigene ID: UN17139Length: 1161 SSR 
TCTTGTCTTCTCGTCACTCATCTCACACCTTAAGCTTCCCTCAGCTTCAAACAATGGTGTTTGTGAAGCCATCCAAGTCGAACGCG
TACTTCAAGAGGTACCAAGTCAAGTTCAGGAGAAGGAGAGCTGGTAAGACTGACTACAGGGCGAGGATCCGTCTCATCAACCAGGA
CAAGAACAAGTACAACACTCCCAAGTACCGTTTTGTTGTCAGGTTCACCAACAAGGACATAGTCGCGCAGATTGTGTCCGCAAGCA
TTGCTGGTGACATTGTCAAGGCCTCTGCTTACGCGCATGAGTTGCCTCAGTATGGTCTCTCTGTTGGTCTTACCAACTACGCTGCT
GCTTACTGTACTGGGCTTCTTTTGGCTCGCCGTGTTCTGAAGATGTTGGAGATGGATGCAGAGTACGAGGGCAACCTTGAGGCTAC
CGGGGAGGACTTCTCCGTTGAGCCAACTGAGTCAAGGAGACCATTCCGTGCTCTTCTTGATGTTGGTCTCATCAGGACCACAACAG
GAAACCGTGTCTTCGGTGCACTCAAGGGAGCCTTGGACGGAGGACTTGATATCCCCCACAGTGACAAGAGATTCGCTGGTTTCAGC
AAGGAGAACAAGAACCTCGATGCTGAGATCCACAGGAACTACATCTATGGTGGTCACGTCTCGAACTACATGAAGATGTTGAACGA
GGATGAGCCAGAGAAGTTTCAGACTCACTTCAGTCAGTACTTGAAGAAGGGAGTTGATGCTGAGAAGATGGAGGAGTTGTACAAGA
AGGTTCATGCTGCCATCCGTGCTGACCCCAACCCTAAGAAGACTGTGAAACCTGCTCCCAAGGCACACAAGAGGTACAACTTGAAG
AAGTTGACCTATGAGGAGAGGAAGAACAAGTTGATCGAGAGAGTCAAGGCATTGAACGGAGCGGCTGGAGGTGATGATGATGATGA
GGACGACGAAGAGTAAAGCACTGGAAAGTTCAGCGTCTCCTGATGATGTCTCTTGTAGGAGCTTTTACTTTTTTTGCAAGACTTGA
GCATTAAACTTTTGTTTTCACTTTTAATTTCGTTTGAGGATTTTGAGTATGAGGATGCTATTTTCTTTGAAGAAGTTAAATCTTTT
TGACATTTTCATGAATTTGCAGTTTATAATCTTATGCCTACTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002870764 hypothetical protein ARALYDRAFT_916328 [Arabidopsis lyrata subsp. lyrata]14672e-160
NP_566767 60S ribosomal protein L5-1 [Arabidopsis thaliana]14602e-159
AAM64753 ribosomal protein, putative [Arabidopsis thaliana]14412e-157
NP_198790 60S ribosomal protein L5-2 [Arabidopsis thaliana]14342e-156
XP_002277820 PREDICTED: hypothetical protein isoform 1 [Vitis vinifera]13231e-143

Swiss-Prot top hits (Blast detail)Scoree value
Q8LBI1 60S ribosomal protein L5-114607e-161
P49227 60S ribosomal protein L5-214347e-158
Q6UNT2 60S ribosomal protein L512903e-141
A2WXX3 60S ribosomal protein L5-112483e-136
Q0JGY1 60S ribosomal protein L5-112447e-136

TrEMBL top hits (Blast detail)Scoree value
B7FJX5 Putative uncharacterized protein13068e-142
A9PFA8 Predicted protein13022e-141
B9SFU0 Ribosomal protein L5, putative12986e-141
C6TL04 Putative uncharacterized protein12852e-139
B9IAZ4 Predicted protein12744e-138

Arabidopsis top hits (Blast detail)Scoree value
AT3G25520.1 ATL5 (A. THALIANA RIBOSOMAL PROTEIN L5); 5S rRNA binding / structural constituent of ribosome14661e-162
AT5G39740.1 60S ribosomal protein L5 (RPL5B)14401e-159

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
77  27%
 
92  8%
 
124  15%
 
62  8%
 
113  12%
 
102  8%
 
85  19%
 
191  4%

Unigene MembersMember information