Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17755

FASTA Sequence
Unigene ID: UN17755Length: 703  SNP
GGAAAACAAAATAAAGTTTCACGTGCAGTTGGAAACAGAGAAATTAAACAAAAACGAAAAAAAAATAGAGAGGTATTACCAGAGAA
GCAAGATGGGCTGCATTGGTCTTATCGATTCAGCCAGTATCAATATTTACCGGCCGGTGCTTACAAGAACATCAAACAAACCCTAC
ACGAGAAGAGGACTATCGATGGCTGCGAGTCGAGCTGAGTCAATGGCTACTGAAAAATTAGGGATCTTTATCGAGAAGAATCCTCC
CGAGTCCAAACTCACCCAACTAGGTGTTCGTAATTGGCCCAAGTGGGGTTGTCCTCCAAGCAAGTTTCCATGGACTTACGATGCAA
AGGAGACTTGTTTTCTGCTAGAAGGGAAAGTGAAAGTTTACCCTAATGGATCCGATGAAGGCGTGGAGATCGAAGCAGGCGACTTT
GTTGTTTTCCCTAAAGGAATGAGTTGCACTTGGGACGTCTCTGTTGCAGTTGATAAGCACTACCAATTCGAGTGAATGGCTATTTA
CTTCTACGTACTCCGCATATTGGTGATATGTTTGATATAGCTTCACTGTCTTTGTATGTTGTGGATACTTAATATAGAAGTTCGTT
TGCGTTATTTAAGACTTTTTAAGGACTTTGTGCATGACATGTCCCAGGATAAAGCAGATAAAGAAAATCAGAGTTCAGATTTGTTC
ATTATGAATCTAGCT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAM62609 unknown [Arabidopsis thaliana]6075e-061
XP_002872504 hypothetical protein ARALYDRAFT_489873 [Arabidopsis lyrata subsp. lyrata]6075e-061
NP_192768 cupin domain-containing protein [Arabidopsis thaliana]5701e-056
ACU16562 unknown [Glycine max]4921e-047
ACU14390 unknown [Glycine max]4841e-046

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q8LEK1 Putative uncharacterized protein6074e-061
Q9SV91 At4g103005707e-057
C6T4F2 Putative uncharacterized protein4928e-048
C6SYR7 Putative uncharacterized protein4847e-047
C6T403 Putative uncharacterized protein4533e-043

Arabidopsis top hits (Blast detail)Scoree value
AT4G10300.1 FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Protein of unknown function DUF861, cupin-3 (InterPro:IPR008579), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G04300.1); Has 356 Blast hits to 356 proteins in 93 species: Archae - 0; Bacteria - 181; Metazoa - 0; Fungi - 0; Plants - 80; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink).5912e-061
AT3G04300.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Protein of unknown function DUF861, cupin-3 (InterPro:IPR008579), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10300.1); Has 364 Blast hits to 364 proteins in 91 species: Archae - 0; Bacteria - 191; Metazoa - 0; Fungi - 0; Plants - 78; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink).3115e-029
AT4G10280.1 FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Protein of unknown function DUF861, cupin-3 (InterPro:IPR008579), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10290.1); Has 293 Blast hits to 293 proteins in 74 species: Archae - 0; Bacteria - 124; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).2353e-020
AT4G28703.1 FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Protein of unknown function DUF861, cupin-3 (InterPro:IPR008579), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G04300.1); Has 311 Blast hits to 311 proteins in 80 species: Archae - 0; Bacteria - 147; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 88 (source: NCBI BLink).1781e-013
AT4G10290.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Protein of unknown function DUF861, cupin-3 (InterPro:IPR008579), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10280.1); Has 242 Blast hits to 242 proteins in 52 species: Archae - 0; Bacteria - 84; Metazoa - 0; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).1753e-013

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
122  6%
 
1110  31%
 
106  19%
 
74  13%
 
66  19%
 
84  13%

Unigene MembersMember information