Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN18588

FASTA Sequence
Unigene ID: UN18588Length: 573 SSR 
GGCACTCCAAAAACGATCGATCTATCTGAATCTTCTCATTTTCCCCCTTTTCTCCGTTTCATAGCTAGCTAGGGTTTTCGAGATGG
GTCAGATCCAGTACTCTGACAAATACTTCGACGATACTTTCGAGTACAGGCACGTCGTACTTCCTCCTGAAGTCGCCAAGCTTCTT
CCCAAGAATCGTCTTCTCTCCGAAAATGAGTGGCGTGCGATTGGGGTGCAGCAGAGCCGTGGATGGGTCCATTACGCCATTCATCG
TCCAGAGCCACACATCATGTTGTTCAGGAGGACTCTCAATTACCAGCAGCAGCAGCAGCAGGAGAACCAAGCTCAAAACCTGCTCG
CTAAGTGAATCTGAGTTGTGCTGCGCTACAAACATTGGTTCTTGTTAGCTATTATGTTTCTTGTAAACATGGGTTTGTGAACCACA
ACCTCTAATAACTTTGTGTTCATGTTATCTATCCTTGGTTGGAGAAAAACATGCGAGTGAATGAGTGATAATCTGACTACTTTGAT
GTTATGCATTGTCTTTGTTCATCATGGATTATATCTTTTTCTTTCTGCCTCTTTGTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002879125 cdk-subunit 1 [Arabidopsis lyrata subsp. lyrata]4335e-041
NP_180363 cyclin-dependent kinases regulatory subunit 1 [Arabidopsis thaliana]4326e-041
BAF36296 hypothetical protein [Ipomoea trifida]4254e-040
AAS79576 putative CDK regulatory subunit [Ipomoea trifida]4202e-039
XP_002523737 Cyclin-dependent kinases regulatory subunit, putative [Ricinus communis]4192e-039

Swiss-Prot top hits (Blast detail)Scoree value
O23249 Cyclin-dependent kinases regulatory subunit 14323e-042
A2XCH8 Cyclin-dependent kinases regulatory subunit 14046e-039
Q6PS57 Cyclin-dependent kinases regulatory subunit 14046e-039
Q9SJJ5 Cyclin-dependent kinases regulatory subunit 24046e-039
P55933 Probable cyclin-dependent kinases regulatory subunit3142e-028

TrEMBL top hits (Blast detail)Scoree value
A0A8Z1 Putative uncharacterized protein4253e-040
Q6JJ57 Putative CDK regulatory subunit4201e-039
B9SCL8 Cyclin-dependent kinases regulatory subunit, putative4191e-039
Q6T300 Cyclin-dependent kinases regulatory subunit4182e-039
A9NIV3 Cyclin-dependent kinases regulatory subunit4163e-039

Arabidopsis top hits (Blast detail)Scoree value
AT2G27960.1 CKS1 (CYCLIN-DEPENDENT KINASE-SUBUNIT 1); cyclin-dependent protein kinase/ protein binding4387e-044
AT2G27970.1 CKS2 (CDK-subunit 2); cyclin-dependent protein kinase/ cyclin-dependent protein kinase regulator4046e-040

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
117  35%
 
72  10%
 
81  5%
 
103  15%
 
124  20%
 
191  5%
 
62  10%

Unigene MembersMember information