Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN18934

FASTA Sequence
Unigene ID: UN18934Length: 1489 SSR 
GTATTATTCACGACACTTCATAATTGTCAATTTCATTATAAACCCACATTGCAAAACCGAAAGGATAACAAAAATGGATTTGAAAC
ATGGGAAACAAAGAGGTCCTCTGTCCCATCTCTGACACAAACTCTGAAAACACAATTCGCATGGTCTTATTGAGAACACAATAGTG
ATTGGTAGAAAACACAAACACGGTCTTATTGATAGGTAACGCCTTCACCGTTTATAACCTCTCCAATGCGATATGCAACATAGTCT
CCATTCTTGGCTTCTCCAAGTATTCTCAAGGCAGCCTCTGGGCTAACCACCATCACCATCCCTATTCCCAGGTTAAACGTCCTTCG
CATCTCACTGTCTTCTATTCTCCCAGACTGTTGGATCCATTTGAACAAAGGTGGAAGTTCCCAAGCATCAGTGTGGATAACAGCAC
CCAAACCATCAGGGAAGACACGGGGAATGTTGTCTGTGAAACCTCCTCCTGTTATATGAGCTATCCCTTTCACTCCTCCTCTGCTA
ATTATGTCAAGTACCTGCTTCACATAAATGACAGTGGGTGCCATTAAAGCTTCTCCAAGGGTAGTTGATCCACCTGGAAGTTCATC
TTTCAGCGAAAGACCGCTTCGAGCCACGACCTTTCTTACTAAAGAGAAACCATTGGAATGAACACCGCTAGAAGGGAGGCCAATAA
GTACATCTCCAGCGACAATGTTTTTCCCGTTTATAACAGAATCTTTCTTCACTATCCCAACTGCAAACCCACTGAGATCGTACTCT
CCCTCTGCGTAAAAGTCAGGCATCTCTGCAGTCTCCCCACCTAGGAGAGCACAGTCTGATTGCCCACAGCCATCAACAATCCCTTT
AATAACCTTCTCTGCAAGGTCTACATCAAGACGGCTAGTAGCAAAGTAATCAAGGAAAAACAGAGGCTTCGCACCGGAAGTAACAA
TATCATTCACACTCATAGCAACCAAGTCGATTCCAATGGTGTGATGGATTCCAGTCTCAAAGGCCAACTTAAGTTTAGTCCCTACA
CCATCCGTACCAGCTACGAGATAAGAATCACCTAACGGAAAGAGACCACCGAATCCGCCGATTCCAGGAGCCATCTTCGCGATTCT
TCTAACGAGCTCGGTCCCGGCATCGATATCAACACCTGAACCCTTGTAACTGAGACTCTCGGTGTTGTCATCTTTCTTGGACAAGG
ATAAAACACTTGTTGTTGTTGTTCTCGTTCTCTGAGGAAAGTTGACGGAGAGAGGCTTCGGAGATGATGATGAAACGGAGGAGAAA
CGGTATCGAGTGGTGGAGCCGGATGAGAAGCAGCGAGAAGAAGATTGCAAAATTTGAGCTTCCATGGCTTAAACAGCAACAAGAGT
TAAAAGAGTAATAATCAACACAGGTCAAATGGACAAGATATGAAAACAGGTCCAAAGATTTGCGACTGTGTCCCGAGAGAGAGAGA
GAGAGACTGAGAATGAGCCTCGTGCCG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002876282 chloroplast phosphoribosylformylglycinamidine cyclo-ligase [Arabidopsis lyrata subsp. lyrata]16871e-185
NP_191061 phosphoribosylformylglycinamidine cyclo-ligase [Arabidopsis thaliana]16861e-185
AAC37341 5'-phosphoribosyl-5-aminoimidazole synthetase [Arabidopsis thaliana]14835e-162
XP_002275035 PREDICTED: hypothetical protein [Vitis vinifera]14558e-159
CBI36923 unnamed protein product [Vitis vinifera]14558e-159

Swiss-Prot top hits (Blast detail)Scoree value
Q05728 Phosphoribosylformylglycinamidine cyclo-ligase, chloroplastic16866e-187
P52424 Phosphoribosylformylglycinamidine cyclo-ligase, chloroplastic/mitochondrial13972e-153
Q2Y5R7 Phosphoribosylformylglycinamidine cyclo-ligase8632e-091
Q7NS12 Phosphoribosylformylglycinamidine cyclo-ligase8489e-090
A9LZD2 Phosphoribosylformylglycinamidine cyclo-ligase8416e-089

TrEMBL top hits (Blast detail)Scoree value
A5BS32 Phosphoribosylformylglycinamidine cyclo-ligase14556e-159
Q6T7F2 Phosphoribosylformylglycinamidine cyclo-ligase14313e-156
B9RNH2 Phosphoribosylformylglycinamidine cyclo-ligase14036e-153
A5AJ03 Phosphoribosylformylglycinamidine cyclo-ligase13964e-152
B9GSG0 Phosphoribosylformylglycinamidine cyclo-ligase (Fragment)13955e-152

Arabidopsis top hits (Blast detail)Scoree value
AT3G55010.1 PUR5; ATP binding / phosphoribosylformylglycinamidine cyclo-ligase16874e-188
AT3G55010.2 PUR5; ATP binding / phosphoribosylformylglycinamidine cyclo-ligase16874e-188

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
91  10%
 
62  20%
 
113  30%
 
191  10%
 
101  10%
 
181  10%
 
211  10%

Unigene MembersMember information