Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN18971

FASTA Sequence
Unigene ID: UN18971Length: 1288 SSR 
GGGAGCTCCGTTCTTCCTCTGTTTACTTGTCTTCTTCCCTTGACACTGCTACTCAGATCCTCCCGGTTTACGCGGGAACAGCGTCG
ACTGAACCGTTCAGCTTACGACGGACATTCCTCCGTGGAGTCTGTCTCGCAGCATTCCCGTCTCTCTCGCACCTGATTCGTCCATC
ATGTGAAAGGAAGCCCTAGTCGAGTCTCTGTTTCTAGCTTAGGTTTGGTTTCAGAGGAAGGAAGGAAGGAAGGAAGGAACGAACGA
AGATCAAATCGAAGAGGGGTTTCATTAGGAGGGAGGAAGGATGTATCGTGACAAAAAGGGAGAAGCCTTTGTCTATGATCGCCGAA
GTAAATTGTATGAGATGGTGGATGATCCTTCAACAGATTCAATAGTTTCGTGGAGCGAGAGCGGGAAGAGTTTCATCGTTTGGGAT
GACGTGGAGTTTAGAAAAGCTCTTCTTCTTCCCGGAGGGTGCCTTGGATACTTGGGCTTTTCACAATCTCAATCTCAATCTCATGA
GCAATGCGAATACGCATGCCCTTATTTTATGAGAGGCCAGCCTGACCTTAAACCGTCACAAGACGACCTCATTAGAAAGATTGAGA
CCGACAACAACAAGGGCTTGGACAGTAGCAATGATGATGGACTTATTCGCTTTAGCAGCCTTTCTTGCTACCAAGAGATGGCTAGG
CTTGCCAAGAAGGAGCGTCCCCCTTCCTCATCAATTCGATGCCCTCCCCCCCTTTTCATCAGAGACGTGTACGATATGTTGGATGA
TCCTACAGTTGATTCAGTTGTCTCGTGGAGTGAGAGCGGCAAGAGTTTCGTCGTTTGGAATGAATCTAAGTTCCTCGGAGATGTTC
TTCCTAGTCGCTTACCCTTCAATTACAAAGATATGACATCCCTCACCACCCAGTTTCATGCCATTGGCTATACTAAAGTTGAAGAA
TCTGAGCATTGGGAATACGCATCCGATTATTTGGTGAGAGGTCAGCCTCCCCCCCCTAAGGATAAATCCCCATGCACTCCTGGCGG
TCTTATGATTACTCCAGAACTTGCCAGACTCATCGAGAGATCCTTTGCTTGCTCGCAAACAATAAGCTAGTTGCTCTACTCTCGTG
GTTGTTGTTGTTGTTGTTTTCTTAATCGTATTTTATCGTCCTGTTTGAAAAACATTATTATGTTTGGTCTCTCTCTTTTCTTTTAA
CTTATGGTTTGTAAGATACAAAGATGGTTGATGTTTTTTATTTTTCTTTTGCATTTTTAATAAGATAGATCATTATGGTTGATC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002888420 hypothetical protein ARALYDRAFT_894128 [Arabidopsis lyrata subsp. lyrata]2343e-017
XP_002267171 PREDICTED: hypothetical protein [Vitis vinifera]2102e-014
CBI30730 unnamed protein product [Vitis vinifera]2102e-014
CAN80282 hypothetical protein VITISV_017449 [Vitis vinifera]2083e-014
XP_002278037 PREDICTED: hypothetical protein [Vitis vinifera]2083e-014

Swiss-Prot top hits (Blast detail)Scoree value
O49403 Heat stress transcription factor A-4a1972e-014
P41153 Heat shock factor protein HSF81945e-014
Q40152 Heat shock factor protein HSF81936e-014
Q84T61 Heat stress transcription factor A-11911e-013
P41151 Heat stress transcription factor A-1a1839e-013

TrEMBL top hits (Blast detail)Scoree value
A5APH3 Putative uncharacterized protein2082e-014
B9IA41 Predicted protein2029e-014
B9S8F1 Heat shock factor protein, putative2029e-014
A9NUX6 Putative uncharacterized protein2011e-013
B9I1G8 Predicted protein2011e-013

Arabidopsis top hits (Blast detail)Scoree value
AT4G18880.1 AT-HSFA4A; DNA binding / transcription factor1972e-015
AT4G18870.1 heat shock transcription factor family protein1892e-014
AT1G32330.1 ATHSFA1D; DNA binding / transcription factor1838e-014
AT4G17750.1 HSF1 (HEAT SHOCK FACTOR 1); DNA binding / protein binding / transcription factor1838e-014
AT5G45710.1 RHA1 (ROOT HANDEDNESS 1); DNA binding / transcription factor1811e-013

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
112  10%
 
126  30%
 
108  40%
 
82  10%
 
91  5%
 
71  5%

Unigene MembersMember information