 |
Information for unigene UN56165
| FASTA Sequence |
| Unigene ID: UN56165 | Length: 457 |
SSR | | GGCTTCAAGTATTGAAAACAACGTTGGGGTTTCCATCTCATTGTATTCAAAAATAATGGTAACACAATGAATTGACATTAATAAGC
AAAAAAAATCAGCTGGTCAAAAACGAATGAATCTGACAACCTCTCTCTCTCTCTCTTTCTCTTTGCTTGCTTCATTTCATTCTGCT
GTTACCTTGATCTGTCCATAAAAATTAGGGTCTGCTTCATAATATACAACATCTCCTTCATCGCTCACAAAATGATCTTCTTTAAT
ACTTTTTGCTAAAATTCCCAGTAAATGTAATGGCAAAGGTCCAAACTTATCAGGCTCCCTGTAATACTTCCCTAATACTGGTTTAA
ATGCTTCTGTTGCTTCTACTAAATGGTAATGTGGGATCTGCGGGAAAAAATGATGTATCACATGTGTTCCAATGTCGTGATGGATG
TTGTTGATCAGTCCGTAATCACGGTCC
|
|
|
| GenBank top hits (Blast detail) | Score | e value |
|---|
| P48618 RecName: Full=Omega-3 fatty acid desaturase, chloroplastic; Flags: Precursor | 503 | 2e-049 |
| AAA61774 omega-3 fatty acid desaturase [Brassica napus] | 503 | 2e-049 |
| ACS26170 chloroplast fatty acid desaturase 7 [Brassica napus] | 500 | 3e-049 |
| AAT02410 chloroplast omega-3 fatty acid desaturase [Brassica napus] | 497 | 8e-049 |
| ABS86961 chloroplast omega-3 fatty acid desaturase [Descurainia sophia] | 480 | 7e-047 |
| Swiss-Prot top hits (Blast detail) | Score | e value |
|---|
| P48618 Omega-3 fatty acid desaturase, chloroplastic (Fragment) | 503 | 1e-050 |
| P46310 Omega-3 fatty acid desaturase, chloroplastic | 474 | 3e-047 |
| P48622 Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic | 423 | 2e-041 |
| P48619 Omega-3 fatty acid desaturase, chloroplastic | 411 | 5e-040 |
| P48620 Omega-3 fatty acid desaturase, chloroplastic | 398 | 2e-038 |
| TrEMBL top hits (Blast detail) | Score | e value |
|---|
| C5J3R0 Chloroplast fatty acid desaturase 7 | 500 | 2e-049 |
| Q6PN70 Chloroplast omega-3 fatty acid desaturase | 497 | 5e-049 |
| B4X945 Chloroplast omega-3 fatty acid desaturase | 480 | 5e-047 |
| A1E436 Omega-3 fatty acid desaturase | 478 | 8e-047 |
| Q9M4D4 Chloroplast omega-3 fatty acid desaturase | 475 | 2e-046 |
| Arabidopsis top hits (Blast detail) | Score | e value |
|---|
| AT3G11170.1 FAD7 (FATTY ACID DESATURASE 7); omega-3 fatty acid desaturase | 475 | 2e-048 |
| AT5G05580.1 FAD8 (FATTY ACID DESATURASE 8); omega-3 fatty acid desaturase | 423 | 2e-042 |
| AT2G29980.1 FAD3 (FATTY ACID DESATURASE 3); omega-3 fatty acid desaturase | 364 | 2e-035 |
| AT3G12120.1 FAD2 (FATTY ACID DESATURASE 2); delta12-fatty acid dehydrogenase/ omega-6 fatty acid desaturase | 160 | 7e-012 |
| AT3G12120.2 FAD2 (FATTY ACID DESATURASE 2); delta12-fatty acid dehydrogenase/ omega-6 fatty acid desaturase | 160 | 7e-012 |
| EST library breakdown for ESTs in the assembly |
| Library |
ESTs | Percentage of ESTs in assembly |
|
|
| Unigene Members | |
 |
|
|
