Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN68879

FASTA Sequence
Unigene ID: UN68879Length: 268 SSR 
GGATATCCAAACACACCTCTCGTTCACATCTTTCTTCTTTGTAGTGAACAGAAAGGCAGAGAGAGAGAGAGAGATCAGAGGAAGCA
ATGGCGTCGAACTCGCTCATGAGCTGCGGCATCGCCGCCGTATACCCTTCCCTTCTTTCTTCTTCGAAGTCTAAATTCGTCTCCTC
CGGATTTGCCCTCCCCAACGCCGGGAACGTTGGCCGCATCAGAATGGCTGCTCACTGGATGCCCGGCGAGCCACGTCCAGCTTACC
TCGACGGTCT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_191049 light-harvesting complex I chlorophyll a/b binding protein 1 [Arabidopsis thaliana]2962e-025
NP_850705 light-harvesting complex I chlorophyll a/b binding protein 1 [Arabidopsis thaliana]2962e-025
NP_850706 light-harvesting complex I chlorophyll a/b binding protein 1 [Arabidopsis thaliana]2962e-025
NP_001078288 light-harvesting complex I chlorophyll a/b binding protein 1 [Arabidopsis thaliana]2962e-025
XP_002878004 hypothetical protein ARALYDRAFT_485905 [Arabidopsis lyrata subsp. lyrata]2962e-025

Swiss-Prot top hits (Blast detail)Scoree value
P12360 Chlorophyll a-b binding protein 6A, chloroplastic1774e-013

TrEMBL top hits (Blast detail)Scoree value
A8MS75 Uncharacterized protein At3g54890.42961e-025
Q01667 AT3g548902961e-025
Q3E725 Putative uncharacterized protein At3g54890.22961e-025
Q3EAJ6 Putative uncharacterized protein At3g54890.32961e-025
Q9C5R7 AT3g548902862e-024

Arabidopsis top hits (Blast detail)Scoree value
AT3G54890.2 LHCA1; chlorophyll binding2965e-028
AT3G54890.1 LHCA1; chlorophyll binding2965e-028
AT3G54890.3 LHCA1; chlorophyll binding2965e-028
AT3G54890.4 LHCA1; chlorophyll binding2965e-028

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
121  100%

Unigene Members