 |
Information for unigene UN81374
| FASTA Sequence |
| Unigene ID: UN81374 | Length: 796 |
SSR | | GAAATTATTGATAAAAATAATTCATTCTGCTGTGGATGAAATTCGTTGGGTGGTGAGATTGGGCGAAGAATCATCAAGTCACTGAA
GATGGGAGAGAGAGTGGAGTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTAGGTTTCTTTTTTTTCCAGATTTGAAACCGAAA
CAGACAACAATGTTGTGTCGGAGATTGGTAATTGAGCCTTAGTATCCCTCTGAGTAGTGTTGGAGGTACTCTTACAACTCCTTTCC
TTGGAAGAGCCTTTCTGGAGATGTCAGCAGCACCAGCAGTGATAGGAAGATGTCCTCTCGTTACAAAGAGAGATTGAGAGGTGGTC
TCGTCAATATCAAGAAAGATGATGCTGTTGCTCTGTTTCAGTCCATGATTATGTCTCGTCCTCTTCCTACGGTCATTGATTTCAGT
AGATTGTTTAGTGGTATTGCTAAAACAAAACAGTATGATCTCGTGTTGGATCTCTGCAAGCAGATGGAATCTAGTGGGGTTGCACA
TAACATCTACACTCTCAACATTATGATCAATTGCTTCTGCCGTCGCCGGAAACTTGGTTTTGCTTTTTCTGCTACGGGAAAGATGT
TGAAACTTGGATATGAGCCTACCACAATCACATTCTCTACTTTGATTAATGGTTTATGTCTCAAGGGTCTAGTTTCCCACGCTGTG
GAGTTAGTTGATCGTATGGTTGAAATGAAGTTGTTCCAAATCTCATCATACTTAACACTCTTGTCATGGTCTTTGTCTCCAAGTAG
AGTGTCTGAAGCATGTCTTTGA
|
|
|
| GenBank top hits (Blast detail) | Score | e value |
|---|
| ABQ50549 hypothetical protein [Brassica rapa] | 589 | 8e-059 |
| ABQ50546 hypothetical protein [Brassica rapa] | 561 | 1e-055 |
| ABQ50556 hypothetical protein [Brassica rapa] | 555 | 7e-055 |
| NP_172694 pentatricopeptide repeat-containing protein [Arabidopsis thaliana] | 547 | 6e-054 |
| AAF79658 F5O11.4 [Arabidopsis thaliana] | 543 | 2e-053 |
| Swiss-Prot top hits (Blast detail) | Score | e value |
|---|
| Q0WKV3 Pentatricopeptide repeat-containing protein At1g12300, mitochondrial | 547 | 3e-055 |
| Q9ASZ8 Pentatricopeptide repeat-containing protein At1g12620 | 534 | 9e-054 |
| Q9LPX2 Pentatricopeptide repeat-containing protein At1g12775, mitochondrial | 518 | 7e-052 |
| Q6NQ83 Pentatricopeptide repeat-containing protein At3g22470, mitochondrial | 492 | 7e-049 |
| P0C7Q7 Putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial | 485 | 4e-048 |
| TrEMBL top hits (Blast detail) | Score | e value |
|---|
| A5JVC4 Putative uncharacterized protein | 589 | 6e-059 |
| A5JVC1 Putative uncharacterized protein | 561 | 1e-055 |
| A5JVD1 Putative uncharacterized protein | 555 | 5e-055 |
| C0MHR3 Pentatricopeptide repeat(PPR)-containing protein At1g12700 | 497 | 3e-048 |
| C0MHR4 Pentatricopeptide repeat(PPR)-containing protein At1g12700 | 481 | 2e-046 |
| Arabidopsis top hits (Blast detail) | Score | e value |
|---|
| AT1G12300.1 pentatricopeptide (PPR) repeat-containing protein | 547 | 3e-056 |
| AT1G12620.1 pentatricopeptide (PPR) repeat-containing protein | 534 | 8e-055 |
| AT1G12775.1 LOCATED IN: mitochondrion; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G12300.1); Has 27792 Blast hits to 6269 proteins in 197 species: Archae - 2; Bacteria - 23; Metazoa - 895; Fungi - 767; Plants - 24554; Viruses - 0; Other Eukaryotes - 1551 (source: NCBI BLink). | 518 | 6e-053 |
| AT3G22470.1 pentatricopeptide (PPR) repeat-containing protein | 492 | 6e-050 |
| AT1G12700.1 helicase domain-containing protein / pentatricopeptide (PPR) repeat-containing protein | 485 | 4e-049 |
| EST library breakdown for ESTs in the assembly |
| Library |
ESTs | Percentage of ESTs in assembly |
|
|
| Unigene Members | |
 |
|
|
