BLASTN 2.9.0+
Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb
Miller (2000), "A greedy algorithm for aligning DNA sequences", J
Comput Biol 2000; 7(1-2):203-14.
Database: User specified sequence set (Input:
/var/www/html/bioinfo/tmp/rose_1110782915233).
1 sequences; 60 total letters
Query= RU03706
Length=1654
Score E
Sequences producing significant alignments: (Bits) Value
yueji_00019 115 1e-30
> yueji_00019
Length=60
Score = 115 bits (60), Expect = 1e-30
Identities = 60/60 (100%), Gaps = 0/60 (0%)
Strand=Plus/Plus
Query 589 ATGATGCTTAAGTATGCATCTTCCCATTCCCAAGTGTAAGCTCCAGATCTTCCACTCCAA 648
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1 ATGATGCTTAAGTATGCATCTTCCCATTCCCAAGTGTAAGCTCCAGATCTTCCACTCCAA 60
Lambda K H
1.33 0.621 1.12
Gapped
Lambda K H
1.33 0.620 1.10
Effective search space used: 83895
Database: User specified sequence set (Input:
/var/www/html/bioinfo/tmp/rose_1110782915233).
Posted date: Unknown
Number of letters in database: 60
Number of sequences in database: 1
Matrix: blastn matrix 1 -2
Gap Penalties: Existence: 2, Extension: 2
|