BLASTN 2.9.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_1353180008913). 1 sequences; 60 total letters Query= RU05081 Length=1100 Score E Sequences producing significant alignments: (Bits) Value yueji_02243 108 2e-28 > yueji_02243 Length=60 Score = 108 bits (56), Expect = 2e-28 Identities = 60/61 (98%), Gaps = 1/61 (2%) Strand=Plus/Plus Query 962 CTGGCGTTTTGTATGGTCTAGAGGTTTCTTGATTTTTTCATTGAAATCTACTCCTTATAG 1021 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct 1 CTGGCGTTTTGTATGGTCTAGAGGTTTCTTGA-TTTTTCATTGAAATCTACTCCTTATAG 59 Query 1022 A 1022 | Sbjct 60 A 60 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.620 1.10 Effective search space used: 55641 Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_1353180008913). Posted date: Unknown Number of letters in database: 60 Number of sequences in database: 1 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 2, Extension: 2 |