BLASTN 2.9.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_1452718154500). 1 sequences; 60 total letters Query= RU55149 Length=171 Score E Sequences producing significant alignments: (Bits) Value yueji_02929 106 9e-29 > yueji_02929 Length=60 Score = 106 bits (55), Expect = 9e-29 Identities = 55/55 (100%), Gaps = 0/55 (0%) Strand=Plus/Plus Query 112 TTCATGTAATGTCTTATAATAAGAAAGAAGATTTTCAGTGATCAAAATCTTTGGG 166 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 TTCATGTAATGTCTTATAATAAGAAAGAAGATTTTCAGTGATCAAAATCTTTGGG 55 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.620 1.10 Effective search space used: 8692 Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_1452718154500). Posted date: Unknown Number of letters in database: 60 Number of sequences in database: 1 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 2, Extension: 2 |