BLASTN 2.9.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_1122255056138). 1 sequences; 60 total letters Query= RU05860 Length=1576 Score E Sequences producing significant alignments: (Bits) Value yueji_05515 94.7 2e-24 > yueji_05515 Length=60 Score = 94.7 bits (49), Expect = 2e-24 Identities = 49/49 (100%), Gaps = 0/49 (0%) Strand=Plus/Minus Query 1147 CCAAATATAGAGAAGAAGAACATGAAAGCAGTTGATATCTGCACTACTC 1195 ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 49 CCAAATATAGAGAAGAAGAACATGAAAGCAGTTGATATCTGCACTACTC 1 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.620 1.10 Effective search space used: 79917 Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_1122255056138). Posted date: Unknown Number of letters in database: 60 Number of sequences in database: 1 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 2, Extension: 2 |