BLASTN 2.9.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_4741938753026). 1 sequences; 60 total letters Query= RU06702 Length=1247 Score E Sequences producing significant alignments: (Bits) Value yueji_05763 90.9 3e-23 > yueji_05763 Length=60 Score = 90.9 bits (47), Expect = 3e-23 Identities = 47/47 (100%), Gaps = 0/47 (0%) Strand=Plus/Plus Query 73 TGCTCTGAATGTCAAAGTGAAGAAATTCAACCAAGCGCGGGTAAACG 119 ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 14 TGCTCTGAATGTCAAAGTGAAGAAATTCAACCAAGCGCGGGTAAACG 60 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.620 1.10 Effective search space used: 63138 Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_4741938753026). Posted date: Unknown Number of letters in database: 60 Number of sequences in database: 1 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 2, Extension: 2 |