BLASTN 2.9.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_7481129289112). 1 sequences; 60 total letters Query= RU06745 Length=626 Score E Sequences producing significant alignments: (Bits) Value yueji_05898 81.3 1e-20 > yueji_05898 Length=60 Score = 81.3 bits (42), Expect = 1e-20 Identities = 46/47 (98%), Gaps = 1/47 (2%) Strand=Plus/Minus Query 86 AAGAAAAAGCTGA-GTAAAACTGATGAGGAAGGTTATACCCTTACTG 131 ||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct 47 AAGAAAAAGCTGAAGTAAAACTGATGAGGAAGGTTATACCCTTACTG 1 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.620 1.10 Effective search space used: 32136 Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_7481129289112). Posted date: Unknown Number of letters in database: 60 Number of sequences in database: 1 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 2, Extension: 2 |