BLASTN 2.9.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_9361218275475). 1 sequences; 60 total letters Query= RU02099 Length=1014 Score E Sequences producing significant alignments: (Bits) Value yueji_06171 100 3e-26 > yueji_06171 Length=60 Score = 100 bits (52), Expect = 3e-26 Identities = 56/57 (98%), Gaps = 1/57 (2%) Strand=Plus/Minus Query 72 CAGCCTCTGCTACTTCATTT-AGTAGTATCATCAGGCTGCGATGGCGTTCTTGAGTA 127 |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 57 CAGCCTCTGCTACTTCATTTTAGTAGTATCATCAGGCTGCGATGGCGTTCTTGAGTA 1 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.620 1.10 Effective search space used: 51255 Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_9361218275475). Posted date: Unknown Number of letters in database: 60 Number of sequences in database: 1 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 2, Extension: 2 |