BLASTN 2.9.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_4555918691653). 1 sequences; 60 total letters Query= RU06449 Length=1257 Score E Sequences producing significant alignments: (Bits) Value yueji_06306 98.5 1e-25 > yueji_06306 Length=60 Score = 98.5 bits (51), Expect = 1e-25 Identities = 59/61 (97%), Gaps = 2/61 (3%) Strand=Plus/Minus Query 587 AGAGTCACGCGCGCTCCTCTTGGGGTCGGTGGCTGAGAA-GACTGTGTAGACAAGCACAA 645 ||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| Sbjct 60 AGAGTCACGCGCGCTCCTCTTGGGGTCGGTGGCTGAGAAAGACTGTGTA-ACAAGCACAA 2 Query 646 A 646 | Sbjct 1 A 1 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.620 1.10 Effective search space used: 63648 Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_4555918691653). Posted date: Unknown Number of letters in database: 60 Number of sequences in database: 1 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 2, Extension: 2 |