BLASTN 2.9.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_3687906021691). 1 sequences; 60 total letters Query= RU26420 Length=1289 Score E Sequences producing significant alignments: (Bits) Value yueji_06718 106 7e-28 > yueji_06718 Length=60 Score = 106 bits (55), Expect = 7e-28 Identities = 55/55 (100%), Gaps = 0/55 (0%) Strand=Plus/Minus Query 5 AAACGAAACTGGTCTCTCTCTTAATTAATACGTACTGGCTTCTCTTACTCTATGA 59 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 55 AAACGAAACTGGTCTCTCTCTTAATTAATACGTACTGGCTTCTCTTACTCTATGA 1 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.620 1.10 Effective search space used: 65280 Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_3687906021691). Posted date: Unknown Number of letters in database: 60 Number of sequences in database: 1 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 2, Extension: 2 |