BLASTN 2.9.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_8449668098214). 1 sequences; 60 total letters Query= RU51770 Length=268 Score E Sequences producing significant alignments: (Bits) Value yueji_07064 102 2e-27 > yueji_07064 Length=60 Score = 102 bits (53), Expect = 2e-27 Identities = 59/61 (97%), Gaps = 1/61 (2%) Strand=Plus/Plus Query 64 CAAATGGCTTCTTCAGATTTCACAGACCCTTGAATTCATAGTCATCTCCTTCTTTTTTCC 123 |||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| Sbjct 1 CAAATGGCTTCTACAGATTTCACAGACCCTTGAATTCATAGTCATCT-CTTCTTTTTTCC 59 Query 124 T 124 | Sbjct 60 T 60 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.620 1.10 Effective search space used: 13520 Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_8449668098214). Posted date: Unknown Number of letters in database: 60 Number of sequences in database: 1 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 2, Extension: 2 |