BLASTN 2.9.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_7681907376713). 1 sequences; 60 total letters Query= RU06299 Length=2294 Score E Sequences producing significant alignments: (Bits) Value yueji_07470 98.5 2e-25 > yueji_07470 Length=60 Score = 98.5 bits (51), Expect = 2e-25 Identities = 51/51 (100%), Gaps = 0/51 (0%) Strand=Plus/Minus Query 1651 AGCCGAGTTTGTGCCAAGTGCTGAGGATGCTTACACAATCATATTGCAAAA 1701 ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 60 AGCCGAGTTTGTGCCAAGTGCTGAGGATGCTTACACAATCATATTGCAAAA 10 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.620 1.10 Effective search space used: 114200 Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_7681907376713). Posted date: Unknown Number of letters in database: 60 Number of sequences in database: 1 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 2, Extension: 2 |