BLASTN 2.9.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_2132878222941). 1 sequences; 60 total letters Query= RU06373 Length=1417 Score E Sequences producing significant alignments: (Bits) Value yueji_07710 85.1 2e-21 > yueji_07710 Length=60 Score = 85.1 bits (44), Expect = 2e-21 Identities = 56/59 (95%), Gaps = 3/59 (5%) Strand=Plus/Minus Query 864 AAAAG-TACTACCTGCAAGGCGAGAAGAAAGGAAA-CGTAGAGAA-CTTCATTGACAAC 919 ||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||||| Sbjct 59 AAAAGTTACTACCTGCAAGGCGAGAAGAAAGGAAAACGTAGAGAACCTTCATTGACAAC 1 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.620 1.10 Effective search space used: 71808 Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_2132878222941). Posted date: Unknown Number of letters in database: 60 Number of sequences in database: 1 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 2, Extension: 2 |