Blast search results


	BLASTN 2.9.0+


Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb
Miller (2000), "A greedy algorithm for aligning DNA sequences", J
Comput Biol 2000; 7(1-2):203-14.



Database: User specified sequence set (Input:
/var/www/html/bioinfo/tmp/rose_1826459635953).
           1 sequences; 60 total letters



Query= RU06648

Length=1270
                                                                      Score        E
Sequences producing significant alignments:                          (Bits)     Value

yueji_07935                                                           115        9e-31


> yueji_07935
Length=60

 Score = 115 bits (60),  Expect = 9e-31
 Identities = 60/60 (100%), Gaps = 0/60 (0%)
 Strand=Plus/Minus

Query  747  TGCCAAAGGTAGGACTACCCTGTGAACCATAGAAGACCTTCTTGAGGTAACCTTTTTCCA  806
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  60   TGCCAAAGGTAGGACTACCCTGTGAACCATAGAAGACCTTCTTGAGGTAACCTTTTTCCA  1



Lambda      K        H
    1.33    0.621     1.12 

Gapped
Lambda      K        H
    1.33    0.620     1.10 

Effective search space used: 64311


  Database: User specified sequence set (Input:
/var/www/html/bioinfo/tmp/rose_1826459635953).
    Posted date:  Unknown
  Number of letters in database: 60
  Number of sequences in database:  1



Matrix: blastn matrix 1 -2
Gap Penalties: Existence: 2, Extension: 2