BLASTN 2.9.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_1174091357711). 1 sequences; 60 total letters Query= RU01685 Length=1762 Score E Sequences producing significant alignments: (Bits) Value yueji_08111 110 7e-29 > yueji_08111 Length=60 Score = 110 bits (57), Expect = 7e-29 Identities = 57/57 (100%), Gaps = 0/57 (0%) Strand=Plus/Plus Query 1648 CTCTTGATGGTACTGTGTGTGATAAGTGAAAGTCAAATTGTTGGGCAATTTTCTTCA 1704 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CTCTTGATGGTACTGTGTGTGATAAGTGAAAGTCAAATTGTTGGGCAATTTTCTTCA 57 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.620 1.10 Effective search space used: 89403 Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_1174091357711). Posted date: Unknown Number of letters in database: 60 Number of sequences in database: 1 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 2, Extension: 2 |