BLASTN 2.9.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_3818650614443). 1 sequences; 60 total letters Query= RU26586 Length=330 Score E Sequences producing significant alignments: (Bits) Value yueji_08388 111 3e-30 > yueji_08388 Length=60 Score = 111 bits (58), Expect = 3e-30 Identities = 58/58 (100%), Gaps = 0/58 (0%) Strand=Plus/Plus Query 172 AAGTCCCTTTTGCAAAATTATCGCATAGCTTTGTCCTATAGTTGCTTCCTGGAGGAGC 229 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 AAGTCCCTTTTGCAAAATTATCGCATAGCTTTGTCCTATAGTTGCTTCCTGGAGGAGC 58 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.620 1.10 Effective search space used: 16744 Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_3818650614443). Posted date: Unknown Number of letters in database: 60 Number of sequences in database: 1 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 2, Extension: 2 |