BLASTN 2.9.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_8294084503754). 1 sequences; 60 total letters Query= RU03010 Length=245 Score E Sequences producing significant alignments: (Bits) Value yueji_08591 96.6 1e-25 > yueji_08591 Length=60 Score = 96.6 bits (50), Expect = 1e-25 Identities = 58/60 (97%), Gaps = 2/60 (3%) Strand=Plus/Plus Query 175 GAGCTGCTTCTTCCTCCGTCACAATTGAGATACTTATTTCTCTCTTTT-CTGAA-TATCA 232 |||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| Sbjct 1 GAGCTGCTTCTTCCTCCGTCACAATTGAGATACTTATTTCTCTCTTTTTCTGAAATATCA 60 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.620 1.10 Effective search space used: 12324 Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_8294084503754). Posted date: Unknown Number of letters in database: 60 Number of sequences in database: 1 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 2, Extension: 2 |