BLASTN 2.9.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_2793610502007). 1 sequences; 60 total letters Query= RU06649 Length=672 Score E Sequences producing significant alignments: (Bits) Value yueji_08607 100 2e-26 > yueji_08607 Length=60 Score = 100 bits (52), Expect = 2e-26 Identities = 60/62 (97%), Gaps = 2/62 (3%) Strand=Plus/Plus Query 338 AGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTAATTCAACCTTAGTACG 397 ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| Sbjct 1 AGACAGGTTAGTTTTACCC-ACTGATGACAGTGTCGCAATAGTAATTCAACCT-AGTACG 58 Query 398 AG 399 || Sbjct 59 AG 60 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.620 1.10 Effective search space used: 34528 Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_2793610502007). Posted date: Unknown Number of letters in database: 60 Number of sequences in database: 1 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 2, Extension: 2 |