BLASTN 2.9.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_8326079103603). 1 sequences; 60 total letters Query= RU06552 Length=734 Score E Sequences producing significant alignments: (Bits) Value yueji_10341 96.6 3e-25 > yueji_10341 Length=60 Score = 96.6 bits (50), Expect = 3e-25 Identities = 58/60 (97%), Gaps = 2/60 (3%) Strand=Plus/Plus Query 581 ATACCACT-ACTTTTAACGTTATTTTACTTATTCCGTGAATCGGAGGCGGGGGC-ACTGC 638 |||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct 1 ATACCACTAACTTTTAACGTTATTTTACTTATTCCGTGAATCGGAGGCGGGGGCGACTGC 60 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.620 1.10 Effective search space used: 36975 Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_8326079103603). Posted date: Unknown Number of letters in database: 60 Number of sequences in database: 1 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 2, Extension: 2 |