BLASTN 2.9.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_3169604352183). 1 sequences; 60 total letters Query= RU04053 Length=1835 Score E Sequences producing significant alignments: (Bits) Value yueji_10379 90.9 4e-23 > yueji_10379 Length=60 Score = 90.9 bits (47), Expect = 4e-23 Identities = 57/60 (95%), Gaps = 2/60 (3%) Strand=Plus/Plus Query 1133 TTCACGTCAGCTTGTCTTCTGTCATATTTTT-GTT-CCCTTCTGAGGTTAGCAATGCCAC 1190 ||||||||||||||||||||||||||||||| ||| |||||| ||||||||||||||||| Sbjct 1 TTCACGTCAGCTTGTCTTCTGTCATATTTTTTGTTCCCCTTCCGAGGTTAGCAATGCCAC 60 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.620 1.10 Effective search space used: 93126 Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_3169604352183). Posted date: Unknown Number of letters in database: 60 Number of sequences in database: 1 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 2, Extension: 2 |