BLASTN 2.9.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_4424689624897). 1 sequences; 60 total letters Query= RU06019 Length=1124 Score E Sequences producing significant alignments: (Bits) Value yueji_12687 90.9 3e-23 > yueji_12687 Length=60 Score = 90.9 bits (47), Expect = 3e-23 Identities = 53/55 (96%), Gaps = 1/55 (2%) Strand=Plus/Minus Query 15 AAAAT-AAATATCAATATACTTCGGTTGGTTTCGATACACATAAGACAGCACTGG 68 ||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 55 AAAATAAAATATCAATATACTTCGGTTGGTTTCGATACACAGAAGACAGCACTGG 1 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.620 1.10 Effective search space used: 56865 Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_4424689624897). Posted date: Unknown Number of letters in database: 60 Number of sequences in database: 1 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 2, Extension: 2 |