BLASTN 2.9.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_4185765102479). 1 sequences; 60 total letters Query= RU03611 Length=441 Score E Sequences producing significant alignments: (Bits) Value yueji_12744 106 2e-28 > yueji_12744 Length=60 Score = 106 bits (55), Expect = 2e-28 Identities = 59/60 (98%), Gaps = 1/60 (2%) Strand=Plus/Plus Query 199 TGCATGAGAAGCAT-AAGGAAAAGAAAGACCCAGAGCATGCCCACAAGCACAAGATAGAA 257 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 TGCATGAGAAGCATAAAGGAAAAGAAAGACCCAGAGCATGCCCACAAGCACAAGATAGAA 60 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.620 1.10 Effective search space used: 22516 Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_4185765102479). Posted date: Unknown Number of letters in database: 60 Number of sequences in database: 1 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 2, Extension: 2 |