BLASTN 2.9.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_8171094354215). 1 sequences; 60 total letters Query= RU03926 Length=835 Score E Sequences producing significant alignments: (Bits) Value yueji_14025 111 8e-30 > yueji_14025 Length=60 Score = 111 bits (58), Expect = 8e-30 Identities = 58/58 (100%), Gaps = 0/58 (0%) Strand=Plus/Plus Query 767 TATGATGAACCATTGGGAAAGCACGATGGCATGGTGAAAGGAACTCGTTACTTCAATT 824 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3 TATGATGAACCATTGGGAAAGCACGATGGCATGGTGAAAGGAACTCGTTACTTCAATT 60 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.620 1.10 Effective search space used: 42126 Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_8171094354215). Posted date: Unknown Number of letters in database: 60 Number of sequences in database: 1 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 2, Extension: 2 |