BLASTN 2.9.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_3364687721218). 1 sequences; 60 total letters Query= RU06700 Length=3217 Score E Sequences producing significant alignments: (Bits) Value yueji_14540 87.0 1e-21 > yueji_14540 Length=60 Score = 87.0 bits (45), Expect = 1e-21 Identities = 53/55 (96%), Gaps = 2/55 (4%) Strand=Plus/Plus Query 2071 AGTAAAACTGATGAGGAAGGTTATACCCTTACTGATGCTTCCC-AGC-TCCTTCT 2123 ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| Sbjct 6 AGTAAAACTGATGAGGAAGGTTATACCCTTACTGATGCTTCCCCAGCCTCCTTCT 60 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.620 1.10 Effective search space used: 160350 Database: User specified sequence set (Input: /var/www/html/bioinfo/tmp/rose_3364687721218). Posted date: Unknown Number of letters in database: 60 Number of sequences in database: 1 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 2, Extension: 2 |