EST translation and GO annotation for unigene RU28375


ESTScan predicted protein sequence

XYPKPPPLSSPPPPPHHHDYPKPPSPSPPPPPHHHHHHHYPKPSPPPPSP

ESTScan predicted coding region in original sequence      Start : 1 End : 148 Strand : minus


XACTATCCCAAGCCACCGCCTCTGTCATCTCCTCCTCCACCACCTCATCACCATGACTATCCTAAGCCACCATCTCCATCACCTCCACCG
CCACCACATCATCATCATCATCATCACTACCCTAAACCATCACCACCTCCACCATCTCCX


X -- added by ESTScan; agctn -- deleted by ESTScan; AGCTN -- CDS



InterProtein domain annotations

Pfam domain annotations

GO terms for RU28375 (based on the top Swiss-Prot and TrEMBL hits)


GO Biological Process
   GO:0009664-plant-type cell wall organization
GO Molecular Function
   GO:0005199-structural constituent of cell wall
GO Cellular Component