EST translation and GO annotation for unigene RU29189


ESTScan predicted protein sequence

XPYIYKSPPPPPPKYYYKSPPPPTYIYKSPPPPTYIYKSPPPPSPSPSHSPPPPYYYKSP

ESTScan predicted coding region in original sequence      Start : 1 End : 178 Strand : plus


XXGCCATACATCTACAAGTCTCCACCACCACCACCACCAAAGTACTACTACAAGTCTCCACCCCCACCAACTTACATATACAAGTCACCA
CCGCCACCCACATACATCTACAAGTCACCACCACCACCATCACCTTCTCCATCACATTCTCCACCACCACCTTACTATTACAAATCTCCT



X -- added by ESTScan; agctn -- deleted by ESTScan; AGCTN -- CDS



InterProtein domain annotations

Pfam domain annotations

PF04554    Extensin-like region

        GO:0005199     GO:0005199

        GO:0009664     GO:0009664

GO terms for RU29189 (based on the top Swiss-Prot and TrEMBL hits)


GO Biological Process
   GO:0009664-plant-type cell wall organization
GO Molecular Function
   GO:0005199-structural constituent of cell wall
GO Cellular Component