EST translation and GO annotation for unigene RU30368


ESTScan predicted protein sequence

XSSRASDDDENGSTRKKLRLSKDQSAFLEESFKEHSTLNPKQKIALAKX

ESTScan predicted coding region in original sequence      Start : 1 End : 144 Strand : minus


XCGAGTTCAAGAGCGAGTGACGACGACGAGAACGGGTCGACTCGGAAGAAACTCAGGCTCTCCAAGGACCAATCGGCTTTTCTTGAAGAG
AGCTTCAAAGAACACAGCACCTTAAATCCCAAGCAAAAAATAGCTCTGGCAAAAAXX


X -- added by ESTScan; agctn -- deleted by ESTScan; AGCTN -- CDS



InterProtein domain annotations

Pfam domain annotations

GO terms for RU30368 (based on the top Swiss-Prot and TrEMBL hits)


GO Biological Process
   GO:0006350-transcription
  GO:0006355-regulation of transcription, DNA-dependent
  GO:0045449-regulation of transcription
GO Molecular Function
   GO:0003677-DNA binding
  GO:0003700-transcription factor activity
  GO:0016563-transcription activator activity
  GO:0030528-transcription regulator activity
  GO:0043565-sequence-specific DNA binding
GO Cellular Component
   GO:0005634-nucleus