EST translation and GO annotation for unigene RU33235


ESTScan predicted protein sequence

XADGGCGDGQDGGGGGHHTGGGPDVGGAHHGGGGGHHTGGGPDVGGAHX

ESTScan predicted coding region in original sequence      Start : 1 End : 143 Strand : minus


XXTGCAGATGGTGGCTGTGGAGATGGTCAAGATGGAGGCGGCGGCGGCCATCACACAGGTGGTGGACCTGATGTAGGCGGTGCACATCAT
GGCGGCGGCGGCGGCCATCACACAGGTGGTGGACCTGATGTAGGCGGCGCACATCXX


X -- added by ESTScan; agctn -- deleted by ESTScan; AGCTN -- CDS



InterProtein domain annotations

Pfam domain annotations

GO terms for RU33235 (based on the top Swiss-Prot and TrEMBL hits)


GO Biological Process
  GO:0009405-pathogenesis
GO Molecular Function
  GO:0004872-receptor activity
GO Cellular Component
  GO:0016021-integral to membrane