EST translation and GO annotation for unigene RU37753


ESTScan predicted protein sequence

MVVVAVEVVVVVGVVVRVEEXRGGDDGDGEDGGGD

ESTScan predicted coding region in original sequence      Start : 76 End : 179 Strand : minus

CTTTGAATAGGTTGGAAAAGGAACGGGAGTAGCTTGTTCTGGGTTTTGAGCAAAAGATCTGAAATTGGGGCGAACATGGTGGTGGTGGCA
GTTGAAGTGGTGGTGGTGGTGGGGGTGGTGGTGAGGGTTGAGGAAXTAAGGGGTGGTGATGATGGTGATGGAGAAGATGGTGGTGGGGAT



X -- added by ESTScan; agctn -- deleted by ESTScan; AGCTN -- CDS



InterProtein domain annotations

Pfam domain annotations

GO terms for RU37753 (based on the top Swiss-Prot and TrEMBL hits)


GO Biological Process
GO Molecular Function
GO Cellular Component